martes, 31 de julio de 2012

Videos naranjitos (II)

Nas prechosas!!!

Cómo llevamos los calores? Yo con el aire acondicionado jodido, asín que, mal vamos! A tirar de abanicooo!!! XDD

Para aliviar el calor, nada mejor que un zumo... un rico zumo de naranja refrescante!! JAJAJAJA!! Y es que os prometí una entraduca más para los videos naranjosos, solo iba a hacer una, pero el RUN se merece un homenaje a parte XDDDD

Y hablando del Run, la chingu Zoak, mi sunbae changjo, me apercibió de que no había incluido el making off de este fantástico video... Ahora, os lo dejo y no lo voy a comentar, que bastante mal de neuron voy hoy ya, como para ponerme a ver esto por ENESIMA vez y comentarlo con detalle... ahí queda eso... 




Y el making de la canción (gracias again and again Zoak!!! ~♥♥♥)



Que siiiii, que no quiero saber ná, que este video ya lo comenté a lo largo y ancho de toda una entrada y paso de babosear más mi ya maltrecho teclado Y_Y

Así que seguiré baboseando, pero en dosis más pequeñucas XD Es decir, que sus comento un poco de qué va cada video y yastá que si no, me dan las mil, y tampoco quiero eso... 

Vamos a empezar con el causante de todo este despropósito naranja, y es el video del que sus he hablado cienes de veces: Wild Eyes... ASDLFSDLFAÑSDLF Oseaaaaaaa, benditos píxeles, porque el nosebleedeo podría haber sido mortaloso si no es por ellos... El día que vea este video en HD.... UNNNNFFFFFFFFFF!!!



UNFFFFFFFF HASTA CON ALIENS ESPALDEROS OÑOOOOOOO!!! Si no fueran ellos me daría también malrrolleo la queca del principio y todo, pero con son ellos... ADSÑLFAÑLDKAÑF!!!!


Y ya, después de morirme un rato si y otro también, me decidí a ver alguno mas... total, ya estaba muelta, qué mas da!!! Y menos mal, porque ahí venían los seis chulazos dispuestos a demostrarnos que todos y cada uno de ellos eran unos Perfect Man ^^


QUIEN FUERA RAMO'ROSAS!!! Endevé qué manoseo!! De una mano a otraaaa!! ADFJADFAKD Sus juro que non possooooo!! Y eso que no los estoy viendo, sus hablo de memoria, jojojojojo!!!

Y ya, para rematar la jugada y pasar de estado morida a #ZombiSalidorra, sus presento un video en el cual, a cada cual va más de sobrao... Y ese movimiento caderosoooookasñlfjasdkfañsldkfa!!! I CAN'T!!!! Brand New:


ALSDFKAÑLDKFADLSFADFKAÑSDLKFAL!!! ALDFKADLSFKADS? ASLÑDFAKSDÑLFKADS! OTTOKEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE!!!


....


.............


..........................


*cuatro vasos de cocacola (light) después, dos duchas de cubitos y una transfusión urgente...*

Bueno, y de verdad, que no sus quiero quitar más tiempo de vida neuronosa, pero tengo que terminar la entrada... lo mio me está costando, eh? Enga, seguimos con Crazy, que asíns es como nos están dejando los jodíos mamonacos...



Osea, es que no pueden ser más prechosos estos dos!!! Juanito, OTTOKEEEE!!!??? AKSJFALFAKDFJKDF

ARFFF, ARRRRRRRRRFFFFF!!! Enga, FIGHTING pa mi oño, que a este paso lo consigo y tó!! Seguimos con Angel, y ese maravilloso duelo entre URI (de mio, of course) Eric-ssi y el Baladeitor... El Malo maloso (ASDFJASDFSADF) y el Bueno principesco (AKJFALSDFKÑALSDKFAD):


*la madre que te trajo Vane, la próxima vez que te pida videos, mándame de los lunis, yo no sobrevivo hoy a tus recomendaciones AKFALDSKFAFLA_:DFADDFKAKSÑDFJASDF*



Engaaaa y otro mas para el bote y la tenma ya anda desneuroná perdía Throw your fist... Eric-ssi y sus pelos lolazos solo son perdonables por el peazo traje blanco que se calza el jodío!!! AÑLDKFALDF



Y ya, por último.... el más reciente... Tengo que confesar que a cada video suyo que veía más menamoraba toa, pero este último, ya sin pixelar... con los 6 tan PRECIOSOS como están ahora... TAN NAMJASSSSSSS AKSJFASKJFSLKFJSDFSD Pues eso, que no será el mejor (ya sabeis que para mi es el RUN muajajajajaja!!) pero si uno de mis prefes *o* Venus:




Y yaaaa sus voy dejando que me tengo que dar la enésima ducha fria del día y comprobar que mis niveles de globulina o como se llame eso que te hace estar viva pues que estén dentro de los mínimos!!!!


Ya nos veremos en otra entrada!

Annyeong!!! ~..~


domingo, 29 de julio de 2012

Entrada Vagorra

AAAAAAAAAAAAAAWWWWWWWWWWWWWWW!!!!


Hoy estoy vaguísima, y tengo unas cuantas entraducas para terminar, pero es que jodó, con este caló como que no me apetesce hacer nada XDDD

Con la tontería de que este mes he estado trabajando de sol a sol y de luna a luna en ocasiones, al mirar el número de entradas que he publicado, he flipado lacasitos, emanéns y chocolatinas varias en general XDDD Resulta que es el segundo més más prolífico en lo que llevamos de año XDD Ottoké?? Eso quiere decir muchas cosas, entre ellas, que parece que estoy como más hiperorganizada porque sé que no voy a contar con tiempo XDDD

Bueno, antes que todo, video random de relax




Estoy muy contenta porque llevaba mil años buscando esta canción desde que un dia la escuché en los simpsons o alguna serie de esas y me gustó por la paz que da, con sus pajaricos y tó XD Pero no sabía cómo se podía titular, y flipad: Escribí "Shalalalala" y "canción setentera" y coge google y me dice que esta o una de Counting Crows, llamada Mr. Jones. La de los Counting la conozco, viví su evolución de primera mano en la radio, me pilló en mi primera adolescencia (ya sabeis, la segunda es la de rait nau XD) Oseaaaaa, que por descartes... XDDD Yesss, ahí está la Minnie deleitándonos con sus gorjeos XD

ChibiSujus... Qué le pasa a Yesung?? XDDDD

Qué más? He conseguido terminar una serie con la que llevaba desde... marzo? abril? Ainssss, no sé, había momentos que me agobiaba, otros que no me apetecía verla, y este mes por mucho que haya querido, no he sobrepasado los 2 capos por finde... cuando yo me veo una serie de 16 enterica entre el sábado y la madrugada del domingo en mis buenos tiempos XD Estoy muuuuuuy contenta de habermela terminado porque ha sido una serie muy chocante en varios campos. Ya os hablaré de ella ^^

#GrashiassssTenmachanDeNadaChicas UNNNNNNNNNNF!!!


Esta semana no ha habido Chulazo y es la primera semana desde que se instauró la sección en que no aparece ninguno por aqui a alegrarnos la pupila y lo que no es la pupilaaaaa XDDDD Pero no os preocupeis. Ya estoy trabajando en el de la semana que entra mañana así que no creo que me pille desprevenida ^^ A todo esto, solo quedan 8 (o 9 que soy de letras, joder) para llegar a la entrada Chulaza 52.... y sabeis qué significa el número 52??? Pues que ya llevaremos UN AÑO de Chulazos tias... Un año ya!!! Y la empecé una tarde suuuuuuper aburrida buscando FOTACAZAS de aquel que inauguró la sección, InSungcito de mi vida XDDDDD Pues eso, que os informaré de lo que voy a hacer para elegir al Chulazo del año XDDDDD Ya os contaré lo que me ronda la neuron XD

También he retomado brevemente el Shinhwa Broadcast! *__*
Ah! El mes Shinhwa se está alargando un poquico más de lo esperado, pero yo os veo encantadas, soooo, no hay problema en alargar la cosa, no? XDDDD De todas maneras, he cambiado la cabecera (grrrrrracias again Sorita!!! ^^) porque no me podía esperar más, que mola miles de moles!!! Pero sip, aún tengo que sacar un par de entradas naranjosas más ^^

A la playa con las chingus *o al Seúl a comer kimchi, lo que mejor nos pille XD*


Y creo que hasta aqui. ^^ En Agosto, lo mismo se ralentiza esto o se vuelve toloco, quién sabe, porque en principio muchos planes no tengo, pero vaya usté a saber XD Ya me gustaría escribir una entrada diaria XD

Hale, las que os vayais en agosto, pasad unas buenas vacaciones! Y las que no, nos vemos por aqui y por el tuiter me imagino ^^

Sus deseo amol de verano ♪♫


Y como siempre digo, gracias por leer mis coñazos marineros XD 

Annyeong!!! ~..~


martes, 24 de julio de 2012

Especial Jodé que caló: La camisa masculina

...... creo que el título no deja mucho lugar a la imaginación, no???



Pero la prenda de la que vamos a hablar hoy, si, eh??? Oseaaaa, con esa prenda con la que nos dejan entrever algo, un mucho, o simplemente nada porque les aplasta la nuez... Tias, hablamos de la camisa. Hace mil prometí que haría entraduca, y aqui está... Entrada refrescante para este caló... refrescante??? SI! Porque me apuesto a que después de leer ver las fotos sus vais direstas a la dusha...



Osea, porque nunca una prenda que nos aparta de nuestros adorados sixpacks, de nuestros pezzzonacos mordibles, de nuestro triángulo del amol... nunca una prenda que tapa tanto nos provoca tanta reacción hormonosa... 



A mi personalmente, me provoca un deseo de arrancarla... Pero la camisa tiene su intríngulis, eh??? No es como una camiseta que se rasga y ya... no....



Una camisa se puede abrir quitando los botones a bocaos...



Una camisa, hace un ruido erótico totalo.... Ese "RISSSSSSSS!!" que suena cuando la rompes, por ejemplo, por la espalda...



Una camisa es el summun de lo erótico, porque los mamonacos de los nenes se la dejan asíns, desabrochá como quien no quiere la cosa donde más #Tolocas nos pone...



Una camisa se puede llegar a PETAR en el cuerpo del chulazo en cuestión, sin necesidad de mucho esfuerzo por parte de los MÚSCULOS del chulazo en cuestión...



Una camisa, y más si es de manga larga, es necesaria en toda escena pornosa que se precie... Es decir, ese medio arrancar la camisa y que se le quede al chulazo en cuestión enganchá a la altura de los codos para así inmovilizarle...



UNNNNNNNNNNNFFFFFFFFFFFF!!!




Una camisa, con toda la formalidad que da, cuando la llevan arrugá da una sensación de dejadez extrema... como si hubieran pasado el día caminando por el desierto para ir luego a verte... ASLFAÑDLFADSLFADS



Una camisa puede provocar entradas tan desvariantes como esta....



Y REPITO que muchas de las veces no se ve NÁ tias!!!



Asi pués... OTTOKE?? A pedirle cuentas al creador de la camisa, al igual que al del Eyeliner??? En plan "Qué tenías en contra de los ovarios para hacerles esto??"



Yo personalmente ya escribo desde la bañera... No me planteo hacerlo desde ningún otro lado, si no quiero acabar derretía!!





Porque a una le gusta la vestimenta informal, pero, mientras desvariaba he descubierto un mundo de posibilidades camiseras...




Porque, a falta esposas, siempre habrá una manga arrancá a mano...



Porque, pensándolo friamente, a ellos les encanta vernos con caras de animalas de bellota mientras nos peleamos con el tejido de algodón....



Yessss, 100% algodón... suaves.... lisitas.... MORDIBLES...





Osea, que mu jevi tias....



Que yo ya non posso enymoar....


Que después de hoy, no sé como voy a hacer el chulazo de mañana...



Bueno, si....



DESCAMISAO!! AÑDKFASDFLASDLFADLFAKSDF

lunes, 23 de julio de 2012

Libro: Vampiro a mi pesar

Hay veces que un acontecimiento en la vida, marca un antes y un después en nuestra manera de comportarnos o de vivirla... Lo que os quiero contar yo con la reseña de este libro no es algo tan profundo, sino mi paso de la lectura "infantil" a la "juvenil-adulta" XDDD



Os hablo de este libro que será recordado como la lectura veraniega por excelencia de my life. Osea, que recuerdo perfectamente que este libro me lo leí en el año del paso de séptimo a octavo de E.G.B (si niñas, el sistema educativo existente antes de la LOGSE y que le da mil millones de años luz de vueltas de campana!!) por lo que tenía 13 añitos ^^


Y esa tenmachan preteenager le pide a su mamá un libro en la revista del Círculo... Como era de prever, si aparecía un libro de vampiros en el catálogo, tenmachan se lo pedía a su mami... Su mami nunca ha sido muy crítica con lo que leia la preadolescente, prefería que se diera cuenta por ella misma de lo que le gustaba en realidad, aunque esa afinidad por los vampiros desde ya su más tierna infancia, empezaba a preocuparla...XD


El caso es que, chicas, vi el título y casi que no necesité nada más para pedirselo a mi madre. Y cuando llegó lo deboré tias. 


Osea, es un libro inteligentísimo, con grandes dosis de humor, con algo de acción, un poco tétrico, a veces absurdo, con un toque de erotismo, y en el que el sensato es la persona que menos te esperas...

Y de qué va este libro que me dejó tan marcada que lo leo cada vez que puedo y lo he dejado hasta a compañeras de universidad???

Pues de Ilya, un adolescente que vive en el Valle Omiso, en plena Europa de la Edad Media... No se dan fechas, no se dan lugares, pero más o menos yo siempre me he imaginado que se desarrolla en Rusia (por la cosa de los nombres) y sobre el año 1100-1200... por la cosa de lo rústico que es todo XD


Vale, pues Ilya es pastor de cabras. Una mañana se despierta, pero no puede levantarse. Sus ojos no se abren, sus dedos no se mueven, la boca lucha desesperada por emitir algún sonido pero no lo consigue... Su padre le intenta despertar, pero no puede... incluso su hermano menor se le tira encima aplastándole las costillas y haciendo que vea las estrellas, pero aún así sus ojos no se abren enfurecidos, no consigue chillar de dolor, sus manos no consiguen alcanzar el cuello de su hermano para estrangularle un poquito... Y el caso es que es raro, porque él oye todo lo que pasa a su alrededor, puede oler a las cabras en el establo, el olor a licor que desprende su padre, que se encarga de destilar el alcohol para todo el pueblo, el olor a leche del desayuno de su hermano...


Algo va mal. Terriblemente mal. Y lo confirma en cuanto oye a sus familiares pronunciar las palabras: "Oh, Dios mio, Ilya está muerto!" "Muerto??? QUE VOY A ESTAR MUERTO!!! Estoy aquí, os oigo, os huelo... solo que no puedo hablar ni moverme, pero estoy VIVOOO!!"


Ciertamente, Ilya está vivo... pero le está dando un ataque de catalepsia. Lo poco que investigué en la época que me leí el libro y lo que te cuenta además el autor, es que la catalepsia es algo así como la muerte dormida. Es decir, pareces estar muerto, pero en realidad estas teniendo una crisis nerviosa que te impide moverte. Sigues respirando, pero de manera imperceptible, pues la ausencia de movimientos hace que no necesites respirar con normalidad. Ilya, acababa de pasar por un momento traumático la noche anterior... cuál?? Ya lo sabreis si os leeis el libro, jojojo!!!


El caso es que esa crisis nerviosa es la que lleva a nuestro prota a estar muerto... y posteriormente RESUCITAR... porque si niñas, Ilya, como no podía ser de otra manera, despierta de su catalepsia y empieza a chillar a diestro y siniestro que está vivo... en su propio velatorio... Así que bueno, Edad Media, ignorancia supina, un cura fanático y un nene que parece despertar de los muertos... Qué va a ser sino un vampiro???


Pues el pobre desesperao y tal, porque no le crecen los colmillos, no se puede transformar en murciélago, y el pensar en los cuellos de las mujeres viejunas de su aldea le da algo de repelús... Ahora bien, si pudiera morder a Tatiana...


Tias, sé que si os lo leeis me podeis acusar de ser infantiloide por recomendar este libro, pero no os podeis imaginar lo que me reí con él, lo que he disfrutado, la de veces que me lo he leido... Es cortito, Ilya es un amorzote, y el autor sabe perfectamente cómo poner la nota de humor cuando todos se dedican a ser Queen of drama... HIPER-RECOMENDADO, nada de vampiros vegetarianos, ni que brillan en la oscuridad, ni que sufren en silencio por sus anheladas... XD Ya me contaréis si lo leeis!!! ^^

Nos vemos en la próxima entrada!!!


Vampiro a mi pesar
Autor: Andreu Martín
Páginas: 240
Editorial: Anaya (la mia, y la de la foto es de Círculo de lectores) Tapa blanda, 8€
Nota que le doy: 9... quiero continuación!!! ALÑSKFASDÑLFKDSF!!

PD: Me lo he vuelto a empezar a leer AD;FADFÑLAKFAÑLD!!

domingo, 22 de julio de 2012

Topicazos (IX) Se que llegaré ♪♫

Como estamossssssssssssss???? 


Yo bien, beibis, deseando que se pase esta semana y pico, porque joer, ya demasiado curro y poco chulacear hacen de tenma una aburrida... y tal XDDDDDDDDDD



El caso es que las entradas bloggeras no tienen porqué tener STOP mientras haya findes en las que me pueda dedicar a ellas... así que la que lees fue escrita el domingo, para ser publicada un día random, no miercolero XD


Y joerrrrr!!! Que hacía mucho que no se paseaban los #Topicazos por uri blog!!! Y veo con satisfacción que estamos llegando a la decena de entradas topicales!!! Haría más, pero son complicadas, primero piensa el #Topicazo, luego escribela... apuffffffffffff! XDDDDD


El caso es que últimamente he estado con un drama (a últimamente me refiero a ver un capi los findes, que no tengo tiempo para más) que narra la historia de un pobretico huérfano que acaba siendo un exitoso hombre de negocios...


Y es que ese es un tema muy manido en los dramas. Primero de todo tienes que ser huerfanito. Si no de los dos padres, por lo menos de uno. Si puede ser, de dos, que hayan muelto en trágico accidente y te hayan dejado un boli / pañuelo / sudadera / llámalo X que cada vez que lo mires te hagan sentir amol y determinación para conseguir tus objetivos aunque tengas 12 años... Si uno de los progenitores sobrevive al accidente-enfermedad-asesinato, una de dos, o se dará a la bebida, o será una persona débil de mente de la que todo el mundo se rie (qué cruela es la mente del guionista dramero...)


Pues bien, con este cuadro marinero, no se puede hacer otra cosa que sentir amol por el prota o al menos algún sentimiento parecido a la simpatía... Eso si, estos protas pueden llegar a ser cargantes... Del palo de "sonreiré ante las adversidades" y ves que un día le están pegando una paliza y sigue sonriendo o le roban el dinero que ha ganado eslomándose durante una semana y que es lo único que tiene para comer, pero él se carcajea... da igual!!! #SéQueLlegaré, se repite como mantra, una y otra vez...



Y la verdá es el que muchacho lo acaba consiguiendo, no se sabe cómo, porque el éxito no suele salir en los dramas... Suele salir de un avión 5 o 10 años después convertido en un chulazo trajeado o algo asín... Pero no te cuentan cómo se ganó su primer dólar, a lo Tio Gilito ni nada por el estilo, que para miserias, ya está la vida real.... Te cuentan la miseria justa, que es su mielda de infancia o adolescencia, y ya, de repente, aparece engalanado hasta los pelos de las orejas....


Pues eso, y cada vez que recuerda su amargo pasado se sonrie... esa sonrisita que acaba por ponerte nerviosa, eh? Porqué leches sonries si tu vida era un ajco?? Y por qué no nos cuentas el secreto de tu éxito??? Ganaste dinero vendiendo chichles, luego pusiste una tienda de chuches y ahora tienes una fábrica de gominolas??? A ver, cómo, eh? EH???


Pues eso nenas, ahí sus dejo el topicazo del #SéQueLlegaré... ese mantra que se repiten hasta la saciedad, porque si no, estarían todos suicidaos a mitad de serie o argo XDDDD

Annyeong!!! ~..~

jueves, 19 de julio de 2012

Cómic Shinhwa (II)

Chicassssssssss!!! Cómo van los calore??? Yo desde ayer mu malita joder... que el Chulazo se pasa tres pueblos con mi sistema libidoso... Lo pone a mil y luego se larga, dejandome con unas ganas tremendas de... ya sabeis... jodío Señor Luna....


Pero para disipar un poco el calor estival y Eric-oso, os propongo una lectura ligera... Os prometí que continuaría... Os prometí que volverían... Lo que no os dije fue cuando lo harían... pues bien, un mes después vuelve la princess tenmachan y sus aventuras naranjitas... El desenlace en el próximo... que ya he encontrado la carpeta donde lo guardé, así que imagino que no tardaré mucho en publicar!!! 

Hale, a leer la siguiente aventura de la princess y los ahjussis!! ^^








Qué sus ha parecido??? Nos vemos en la siguiente!!! ADÑFLKASFALF!!!!

miércoles, 18 de julio de 2012

Chulazos imprescindibles que no puedes dejar pasar (XLII) Eric Moon Ataca de nuevo XD

Chicasssssss, chicas!!

Aqui estamos, una semana más dispuestas a demoril, eh???? Ya sus veo, ya, que sois mu masocas!!! Pero yo ya voy avisando que el Chulazo de esta semana no es apto para cardiacas... Osea, no, sabeis? Y porqué me he decidido por este Chulazo en especial y no por otro??? 

Pues mu sencillo chingus, estoy muuuuu cansada del curro y cuando arrivo a casa... me merezco un oppa.... Uno que me alegre la neurora, que me de mil latidos por segundo al kokoro, que me haga sonreir, sudorar, emocionarme y perder hemoglobina a partes iguales... Dos chulazos del blog consiguen eso especialmente, uno es el Princeso y otro es CuquiBong... pues bien creo que debo presentaros al tercero en discordia...

Ese tercero arrivó a mi vida desapercibidamente, cuando más enfocada estaba en oppacear a otro... No es que el muchacho pase desapercibido, pero el caló y los sudores biaseadores son mu fuertes, y yo estaba biasando locaementi a su compa de formación...

Ya con esto, va quedando claro al menos, que el Chulazo en cuestión pertenece a un grupo... Ahora bien... qué grupo???, sus preguntareis....




PUES CUAL VA A SER, POL DIOOOOOOOOO!!! Con qué grupo no paro de daros el coñazo últimamente? Con qué chulazo en especial me pongo asín?? Que no lo sabeis??? Pero si estoy harrrrrrrrrrta de gritarlo y escribirlo a los cuatro vientos internetilessssss, pol dioooooooooo!!


Venga, hoy ni pista ni ná, no tengo la neuron para pensar ni para ser ingeniosa cuando este pedazo de NAMJA se cruza en mi camino.... Aviso que la territorialidad puede llegar a ser extrema en esta entrada, tanto o más que en las del Princeso o Cuqui... Vamos con la pic... y a mi me salen los culottes volando por la terraza de la cocina para no volver nevah... A este no le hago un traje de saliva, a este le hago un vestidor entero si hace falta....


ADSLÑFAKSLDKFAÑSD OSTIAAAAAAAAAKLASJDFKALSJDF


ASDFLÑADKFALDÑLFKAÑDSLKFAÑSLDKFLSDKFALS!!!! MASDJFASDFKALSDÑFA?? GAKJDFAKSDJFSD!!! GAKLS!! KALFAOEWF!!! OLEEEEEEEEEEEEEEEEE!!!!!

*SPLASH* *babas al teclado en 3, 2, 1...*


Unffffff, unnfffffff, unfffffffff....

O-JA-ZOS MOON tias.... para servirme...


Venga, va que ya -klasjfñaskjñfalkfañfañdsfkjasñdfaklsñdfasdf!!! NON POSSOOOOOOOOO!!!!

YOOO!!! A MIIII!!! DEJA ESA ALMOHADAAAAA!!!


Osea, lo de este tio es mu fuelte. Me deja desneuroná. Me deja a-ovárica. Me deja ojiplática. Me deja palarrastreeeee!!!

Y ESA EXPRESIÓN??? DE QUE VAAAAAAAAAAS!!! ASKJFAKSDLÑFAKLFA


Y es que si no hubiera sido porque me fijé primero en CuquiBong, mi biaseado naranjoso hubiera sido indiscutible... Pero Cuqui con to lo peque que es, es mucho Cuqui!!!

OLE OLE OLEEEEEEEE LO BIEN HECHO QUE ESTASSSSS


Osea que yesssss, Eric-ssi, #MiChulazo, es de los pocos machus coreanus que realmente me deja alelá... Los hay que me sacan la sonrisa boba, los hay que en determinadas ocasiones me hacen babear cual posesa, pero lo de mi ponimiento con el lidah naranjoso es non stop... cada vez que le veo. Cada vez que escucho su VOZACA. Cada vez que se ríe, llora, suspira, pone cara de pardo o trollea... Cada vez que es genuínamente él.... No lo puedo evitarrrrrrrrrrr!!!

JUAS! Hasta pintado tias.... NON POSSOOOO!!!


Estoy tan descerebrá con él que me he visto todas sus series en tiempo record, contando con que ahora no tengo tiempo ni para hacer pis...

Y el jodío no tiene que ser simpático ni ná!!!


Estoy tan toloca, que he escrito la entrada sin poner una sola imágen porque entonces sí que no hubiera sido capaz de escribir una sola palabra a derechas...

OLEEE LOS CALVIN!!!... Eso es SABER ENSEÑARRRR!!!



El sentimiento de preñez cada vez que le veo es absoluto... Osea, es que no puedo... No puedo tias... Es tan ASDJFADSFADLADSFKD!!! Si fuera adolescente lloraría cual fana con Élvis en sus tiempos mozos... pero soy treintañera y si hago eso, primero, me deshidrataría a más velocidad si cabe, y segundo, si por un casual de la vida se pasara por Supain, mi cara demacrada por el llanto y la babosidad le huiría... Así que, Eric-ssi, vente pa'cá, que verás la carapan saludable que tengo!!!

OPPA PRECIOSOOOOOOOOOOO!!!


Y poco más sus puedo contar de este hombre sin que parezca un desvarío constante.

UNNNNNNNNFF!! OJAZOS+SONRISACAAAA!!! UGAAAAAAUGAUGAUGAUGAAAAAAA!!!


Pero no quiero meter fotos sin sentido y porque si...

QUE OJAZOS TIASSSS... *se va a llorar de amor*


En serio...

UNFFFFFFFFFFFFFFFFFFFFFFFFFF



No...


UNFFFFFFFFFFFFFFFF!!!!!!!!!!!!!!!!!!!


quiero...

UGAAAAAAAAAAAAAAAAAAAAAAAAAA!!!


ADSFKAÑDLFAKFA


BOOOOOOOOOOOOOOOOOM!!! #PreñadaIbnidá


Que no será el mejor actor, pero sí lo intenta con tol kokoro... Que a mi los raperos ni fú ni fá, pero me lleva toloca cuando escucho su voz en la radio... Que es SUPER GUAPOSO, está más que claro...

Sale #PRECIOSO en todos sus dramas, pero en este... UNFFFFFF!!!


Que tiene una sonrisa que derrite iceberes, también lo está...

GUAPPOOOOO!!! YA no sé cómo ponerlo!!!


Que es de los pocos asiáticos a los que he visto con esa barrrrrrrrrrrrrrrrba pornosa y que le queda de muelte también....


PA QUÉ TE ME AFEITAS, EH????? ALDFAÑLKFASDF

Y que no paro de preguntarme porqué coño no lo había chulazeado ya!!! Bueno, si, sé la razón... No lo quería compartir, joder XDDDDDDDDDDDD Pero si hago un mes Shinhwa y entradas chulazas de los Shinhwa y no le incluyo a él... hubiera sido pa matarme, a que si???

Estilismos horteras a él... ÉL PUEDE CON ESO Y MÁS OÑO!!! AKFAÑLDF


Bueno, pues eso, sus voy compartiendo, pero a distancia y tranquilitas, eh??? Que el NAMJA is mine!!! ENDEVÉ!!! Dejadme sólo esos tres a mi oño!!! Todos los demás para vosotras, pero no me les toqueis... de hecho, me molaría que ni les rozarais ocularmente, pero no puede ser, así que eso.... se mira pero no se tocaaaaaaaa!!!

Mandandome el guasa de buenos días amol... ~♥♥♥


ASDFJAÑSLDKFASLDF Y ya sus voy dejando no sin antes recordaros que sus datos de la Bio están en su fija naranjita, pero vamos... por refrescar... 1.80 de buenorrosidad testosteronosa de namja y un oppa como una catedral, este Acuario de Febrero del '79... ñaklsdñfaljdñalkjdfañlkjdfa

A este le queda bien cualquier pelo o qué??? ASLÑDFALSFDKAD


Y que no puedo más.... que temo que si sigo hablando, voy a sacaros las arcadas de tanto amor (sisisiis, me pone palotisima, pero también estoy enamorá, passsssssa??) Que me digais lo guapo que es, pero que todo para mi, eh???

PERO QUE BONICOOOOOOOOOOOO!!! ASÑFDLKASLKFA ~♥♥♥


Voy a dedicarle las palabrejas de rigor y a irme a la bañera, que ya la tengo preparada llena de cubitos de hielo, porque... apuffffffffff!! QUE CALÓ!!! Precisamente uno de los días más calurosos del verano y yo me pongo a chulazear a este!! ADLKFAKÑFADF

Vale, debo confesar que... te quiero y tal... *se va haciendo la croqueta*

Eric-ssiiii!!! OPPAAAAAAAAAASJKDFASKFKAÑLSDF!!! Te AKSJDFAKFASLDF y un día de estos te como vivoooo!!! ADSFKAÑSDLFADS Reza por que no me toque la loto, que como me toque y vaya a Corea, yo te secuestroooo!!! AUUUUU!!! La maleta me la compraré bien grande, para que quepas, tú y Mini-Eric, aunque lo de Mini sea mentira y tal UNFFFFFF UNFFFFFFFFFFFFFFFFFF!!!! ESO ES UN ARMARIOOOO??? VEN PA'CAAAAAADLASÑDFLKS!!
JAJAJAJAJA PELO DE AHJUMMA LOCAAA!! Y aún asín tiene su cosa, eh?


Y ya esta... en serio me voy a meter en la bañera cubitosa, porque esto no hay quién lo aguante... no sé si haré más entradas chulazas, porque ya no tengo ovarios. Se los ha cargado el kbron con esos ojazos ALSDFKAFAÑFLKFF

Que guapooooooooooo!!!


Annyeong!!! TT____TT

http://1.bp.blogspot.com/-wZ89sKoJ3mc/UAckw_UZfaI/AAAAAAAAEwc/BYTjhQCr8F8/s1600/Eric-ah+37.jpg
AS:DLFASLDFKAÑSLDKFALSDKFASF BOOOOOOOOOOOOOM!!!

LinkWithin

Related Posts Plugin for WordPress, Blogger...