miércoles, 18 de julio de 2012

Chulazos imprescindibles que no puedes dejar pasar (XLII) Eric Moon Ataca de nuevo XD

Chicasssssss, chicas!!

Aqui estamos, una semana más dispuestas a demoril, eh???? Ya sus veo, ya, que sois mu masocas!!! Pero yo ya voy avisando que el Chulazo de esta semana no es apto para cardiacas... Osea, no, sabeis? Y porqué me he decidido por este Chulazo en especial y no por otro??? 

Pues mu sencillo chingus, estoy muuuuu cansada del curro y cuando arrivo a casa... me merezco un oppa.... Uno que me alegre la neurora, que me de mil latidos por segundo al kokoro, que me haga sonreir, sudorar, emocionarme y perder hemoglobina a partes iguales... Dos chulazos del blog consiguen eso especialmente, uno es el Princeso y otro es CuquiBong... pues bien creo que debo presentaros al tercero en discordia...

Ese tercero arrivó a mi vida desapercibidamente, cuando más enfocada estaba en oppacear a otro... No es que el muchacho pase desapercibido, pero el caló y los sudores biaseadores son mu fuertes, y yo estaba biasando locaementi a su compa de formación...

Ya con esto, va quedando claro al menos, que el Chulazo en cuestión pertenece a un grupo... Ahora bien... qué grupo???, sus preguntareis....




PUES CUAL VA A SER, POL DIOOOOOOOOO!!! Con qué grupo no paro de daros el coñazo últimamente? Con qué chulazo en especial me pongo asín?? Que no lo sabeis??? Pero si estoy harrrrrrrrrrta de gritarlo y escribirlo a los cuatro vientos internetilessssss, pol dioooooooooo!!


Venga, hoy ni pista ni ná, no tengo la neuron para pensar ni para ser ingeniosa cuando este pedazo de NAMJA se cruza en mi camino.... Aviso que la territorialidad puede llegar a ser extrema en esta entrada, tanto o más que en las del Princeso o Cuqui... Vamos con la pic... y a mi me salen los culottes volando por la terraza de la cocina para no volver nevah... A este no le hago un traje de saliva, a este le hago un vestidor entero si hace falta....


ADSLÑFAKSLDKFAÑSD OSTIAAAAAAAAAKLASJDFKALSJDF


ASDFLÑADKFALDÑLFKAÑDSLKFAÑSLDKFLSDKFALS!!!! MASDJFASDFKALSDÑFA?? GAKJDFAKSDJFSD!!! GAKLS!! KALFAOEWF!!! OLEEEEEEEEEEEEEEEEE!!!!!

*SPLASH* *babas al teclado en 3, 2, 1...*


Unffffff, unnfffffff, unfffffffff....

O-JA-ZOS MOON tias.... para servirme...


Venga, va que ya -klasjfñaskjñfalkfañfañdsfkjasñdfaklsñdfasdf!!! NON POSSOOOOOOOOO!!!!

YOOO!!! A MIIII!!! DEJA ESA ALMOHADAAAAA!!!


Osea, lo de este tio es mu fuelte. Me deja desneuroná. Me deja a-ovárica. Me deja ojiplática. Me deja palarrastreeeee!!!

Y ESA EXPRESIÓN??? DE QUE VAAAAAAAAAAS!!! ASKJFAKSDLÑFAKLFA


Y es que si no hubiera sido porque me fijé primero en CuquiBong, mi biaseado naranjoso hubiera sido indiscutible... Pero Cuqui con to lo peque que es, es mucho Cuqui!!!

OLE OLE OLEEEEEEEE LO BIEN HECHO QUE ESTASSSSS


Osea que yesssss, Eric-ssi, #MiChulazo, es de los pocos machus coreanus que realmente me deja alelá... Los hay que me sacan la sonrisa boba, los hay que en determinadas ocasiones me hacen babear cual posesa, pero lo de mi ponimiento con el lidah naranjoso es non stop... cada vez que le veo. Cada vez que escucho su VOZACA. Cada vez que se ríe, llora, suspira, pone cara de pardo o trollea... Cada vez que es genuínamente él.... No lo puedo evitarrrrrrrrrrr!!!

JUAS! Hasta pintado tias.... NON POSSOOOO!!!


Estoy tan descerebrá con él que me he visto todas sus series en tiempo record, contando con que ahora no tengo tiempo ni para hacer pis...

Y el jodío no tiene que ser simpático ni ná!!!


Estoy tan toloca, que he escrito la entrada sin poner una sola imágen porque entonces sí que no hubiera sido capaz de escribir una sola palabra a derechas...

OLEEE LOS CALVIN!!!... Eso es SABER ENSEÑARRRR!!!



El sentimiento de preñez cada vez que le veo es absoluto... Osea, es que no puedo... No puedo tias... Es tan ASDJFADSFADLADSFKD!!! Si fuera adolescente lloraría cual fana con Élvis en sus tiempos mozos... pero soy treintañera y si hago eso, primero, me deshidrataría a más velocidad si cabe, y segundo, si por un casual de la vida se pasara por Supain, mi cara demacrada por el llanto y la babosidad le huiría... Así que, Eric-ssi, vente pa'cá, que verás la carapan saludable que tengo!!!

OPPA PRECIOSOOOOOOOOOOO!!!


Y poco más sus puedo contar de este hombre sin que parezca un desvarío constante.

UNNNNNNNNFF!! OJAZOS+SONRISACAAAA!!! UGAAAAAAUGAUGAUGAUGAAAAAAA!!!


Pero no quiero meter fotos sin sentido y porque si...

QUE OJAZOS TIASSSS... *se va a llorar de amor*


En serio...

UNFFFFFFFFFFFFFFFFFFFFFFFFFF



No...


UNFFFFFFFFFFFFFFFF!!!!!!!!!!!!!!!!!!!


quiero...

UGAAAAAAAAAAAAAAAAAAAAAAAAAA!!!


ADSFKAÑDLFAKFA


BOOOOOOOOOOOOOOOOOM!!! #PreñadaIbnidá


Que no será el mejor actor, pero sí lo intenta con tol kokoro... Que a mi los raperos ni fú ni fá, pero me lleva toloca cuando escucho su voz en la radio... Que es SUPER GUAPOSO, está más que claro...

Sale #PRECIOSO en todos sus dramas, pero en este... UNFFFFFF!!!


Que tiene una sonrisa que derrite iceberes, también lo está...

GUAPPOOOOO!!! YA no sé cómo ponerlo!!!


Que es de los pocos asiáticos a los que he visto con esa barrrrrrrrrrrrrrrrba pornosa y que le queda de muelte también....


PA QUÉ TE ME AFEITAS, EH????? ALDFAÑLKFASDF

Y que no paro de preguntarme porqué coño no lo había chulazeado ya!!! Bueno, si, sé la razón... No lo quería compartir, joder XDDDDDDDDDDDD Pero si hago un mes Shinhwa y entradas chulazas de los Shinhwa y no le incluyo a él... hubiera sido pa matarme, a que si???

Estilismos horteras a él... ÉL PUEDE CON ESO Y MÁS OÑO!!! AKFAÑLDF


Bueno, pues eso, sus voy compartiendo, pero a distancia y tranquilitas, eh??? Que el NAMJA is mine!!! ENDEVÉ!!! Dejadme sólo esos tres a mi oño!!! Todos los demás para vosotras, pero no me les toqueis... de hecho, me molaría que ni les rozarais ocularmente, pero no puede ser, así que eso.... se mira pero no se tocaaaaaaaa!!!

Mandandome el guasa de buenos días amol... ~♥♥♥


ASDFJAÑSLDKFASLDF Y ya sus voy dejando no sin antes recordaros que sus datos de la Bio están en su fija naranjita, pero vamos... por refrescar... 1.80 de buenorrosidad testosteronosa de namja y un oppa como una catedral, este Acuario de Febrero del '79... ñaklsdñfaljdñalkjdfañlkjdfa

A este le queda bien cualquier pelo o qué??? ASLÑDFALSFDKAD


Y que no puedo más.... que temo que si sigo hablando, voy a sacaros las arcadas de tanto amor (sisisiis, me pone palotisima, pero también estoy enamorá, passsssssa??) Que me digais lo guapo que es, pero que todo para mi, eh???

PERO QUE BONICOOOOOOOOOOOO!!! ASÑFDLKASLKFA ~♥♥♥


Voy a dedicarle las palabrejas de rigor y a irme a la bañera, que ya la tengo preparada llena de cubitos de hielo, porque... apuffffffffff!! QUE CALÓ!!! Precisamente uno de los días más calurosos del verano y yo me pongo a chulazear a este!! ADLKFAKÑFADF

Vale, debo confesar que... te quiero y tal... *se va haciendo la croqueta*

Eric-ssiiii!!! OPPAAAAAAAAAASJKDFASKFKAÑLSDF!!! Te AKSJDFAKFASLDF y un día de estos te como vivoooo!!! ADSFKAÑSDLFADS Reza por que no me toque la loto, que como me toque y vaya a Corea, yo te secuestroooo!!! AUUUUU!!! La maleta me la compraré bien grande, para que quepas, tú y Mini-Eric, aunque lo de Mini sea mentira y tal UNFFFFFF UNFFFFFFFFFFFFFFFFFF!!!! ESO ES UN ARMARIOOOO??? VEN PA'CAAAAAADLASÑDFLKS!!
JAJAJAJAJA PELO DE AHJUMMA LOCAAA!! Y aún asín tiene su cosa, eh?


Y ya esta... en serio me voy a meter en la bañera cubitosa, porque esto no hay quién lo aguante... no sé si haré más entradas chulazas, porque ya no tengo ovarios. Se los ha cargado el kbron con esos ojazos ALSDFKAFAÑFLKFF

Que guapooooooooooo!!!


Annyeong!!! TT____TT

http://1.bp.blogspot.com/-wZ89sKoJ3mc/UAckw_UZfaI/AAAAAAAAEwc/BYTjhQCr8F8/s1600/Eric-ah+37.jpg
AS:DLFASLDFKAÑSLDKFALSDKFASF BOOOOOOOOOOOOOM!!!

3 comentarios:

  1. Vale, no recuerdo en absoluto lo que escribí cuando salió la entrada de este hombre, por lo que perdería su gracia volver a escribir algo que no coincida con lo que puse en su día.
    Ahora bien, salvo alguna foto que pusiste, tipo pelos de ahjumma loca y alguna otra XDDDDD, en el resto sale de PM, sobre todo las de traje, ahí me puede.
    En el plano de actuación, como ya sabes no aguanté Qué Será Será y en la peli de A Bittersweet Life, lo siento, pero ahí entre Lee Byung Hun que me tenía muerta matá y Shi Min Ah que de nuevo lo bordó, no tenía ojos para nadie más XDDDDD.
    En cuanto al grupo, me encanta cómo rapea a lo que hay que sumar lo tonto que puede llegar a ser, madre mía XDDDDDDDDD.
    Eso sí, que en las fotos lo pongan en uno de los extremos, porque eso de ponerlo siempre al lado de los bajitos, pues como que desluce a estos, la verdad XDDDDDDDDD.

    ResponderEliminar
  2. No me acuerdo casi ni de lo que digo el día anterior como para acordarme de lo que escribí hace meses xDDDDD pero vaya que te lo resumo rapido: ajklajsdfkalsdjlfaksjd *_______________* y después de haberlo visto en la spy(que menos mal que me animé y te hice caso xD)más aún ♥

    ResponderEliminar
  3. Yo tampoco recuerdo qué puse exactamente, pero ahora diré solo una cosa (o dos, o tres...): madremiadelamorhermoso cómo está Ese Señor!!!! Es pornoso a más no poder eeeeeeeeeh? Telita con Ese Señor, joeeeeeeer!

    <3

    ResponderEliminar

LinkWithin

Related Posts Plugin for WordPress, Blogger...